Transferability of Simple Sequence Repeat (SSR) Markers

Transferforce of uncompounded series relate (SSR) markers plain in red clover (Trifolium pratense L.) to some Trifolium species

Abstract

Microsatellite markers earlierly plain for red clover (Trifolium pratense L.) were used in cantankerous-paraphrase criterions of prospect other Trifolium reputation. Of the 20 SSR loci criterioned, 9 (47.37%) had real remainders and were set-up to be alientalented to all prospect reputation criterioned. The enumerate of alleles exposeed at each locus ranged from 4-12, after a conjuncture an mediocre of 7.2 in T. tumens Steven ex M. Bieb., 5.8 in T. resupinatum L., 5.1 in T. fragiferum L., 4.5 in T. tomentosum L., 3.4 in T. bullatum Boiss. & Hausskn. ex Boiss., 3.2 in T. clusii Godr. & Gren., 2.7 in T. spumosum L. and 2.1 in T. physodes Stev. ex M. B. This consider has shown that SSR markers plain for red clover effectually expatiate DNA from other reputation and this advent may be appropriate for the separation of intra- and interrestricted genetic mutation of target Trifolium reputation for which, until now, no advice about their genomic SSR standing has been advantageous.

Keywords: Cross-reputation transmitability, Genomic SSR, Trifolium, T. pratense .

Introduction

Microsatellites, or Uncompounded Series Repeats (SSRs), are one of the most servicetalented DNA markers for considering population genetic composition and dynamics (Moreno et al., 2011; Zhang and Hewitt, 2003). However, the ocean boundary on the use of these markers for separation of genetic mutation in opposed reputation is the excellent absorb for developing restricted primers (Miranda et al., 2012). Thus, a further current use of SSRs in introduces would be facilitated if we were talented to transmit SSR loci abutting reputation (Manoj et al., 2013; Gutierrez et al., 2005). Numerous studies on relatively genetics possess orthodox that gene gratified and direct are excellently conserved unformed air-tight cognate introduce reputation (Manoj et al., 2013; Kalia et al., 2011; Varshney et al., 2005; Kuleung et al., 2004). It is productive fortunate transmitforce depends on the extent of series keeping in the primer seats flanking the microsatellite loci and the arrestation of these seriess during disconnection (Moreno et al., 2011; Zhang and Hewitt, 2003). Therefore, primer spans planned installed on the seriess obtained from one reputation could be used to expose microsatellites in cognate reputation. Several studies possess as-well-mannered evidenced the fortunate cantankerous-transferforce of SSR markers from one reputation to other reputation of the identical individuality (Miranda et al., 2012; Castillo et al., 2008; Gimenes et al., 2007; Alves et al., 2006; Bravo et al., 2006). The cantankerous-transferforce of SSRs is oceanly servicetalented in relatively genome mapping and phylogenetic studies. Also, this course of microsatellite exposeion is specially servicetalented in reputation where neither series advice nor the genetic maps are availtalented (Manoj et al., 2013).

The individuality Trifolium L. is arranged into prospect individualitys including 255 reputation (Gillett and Taylor, 2001; Zohary and Heller, 1984). Numerous members of this reputation possess agronomic prize, including red clover (T. pretense), stainless clover (T. repens), strawberry clover (T. fragiferum), and Persian clover (T. resupinatum). Bar for red and stainless clovers, mean advice is availtalented on the genomics of other members of the individuality.Thus, in the confer-upon consider, we learned the transmitforce of 20 red clover SSR loci to prospect new targets reputation cognate to Fragifera (T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii) and Mistyllus (T. spumosum) individualitys.

Materials and Methods

Plant materials and DNA extraction

Eight Trifolium reputation were learned: T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii and T. spumosum. Plants of each reputation were verified morphologically according to Haerinasab and Rahiminejad (2012).

Leaves from 8 populations of T. fragiferum, 12 populations of T. tumens, 1 population of T. physodes, 11 populations of T. resupinatum, 6 populations of T. bullatum, 3 populations of T. clusii, 14 populations of T. tomentosum and 2 populations of T. spumosum were sampled to criterion transmitforce of primers earlierly plain in red clover (T. pratense ). Genomic DNA was extracted according to Ellison et al. (2006). DNA tension was estimated on 0.8% agarose gels.

Microsatellite markers and PCR separation

Twenty primer spans earlierly plain for T. pratense (Sato et al., 2005) (Ttalented 1) were criterioned in the prospect target reputation.

Ttalented 1 – Primer Sequences and characteristics of 20 criterioned red clover restricted SSR primer spans.

Alelle abundance

Reverse primer (5′ to 3′)

Forward primer(5′ to 3′)

Calculated extent(bp)

SSR motif

SSR ID

No

12

GAAGAGATAGCTTGCCTTGGA

CACGTTACTCAATTTGGATCTTTG

157

AAG

RCS0883*

1

9

TGGGGAAGTGAAGGATGTTC

ATTTGAGCACAAGGCCTCAC

206

AAC

RCS0907

2

6

ATCAACTCGATGGGAACACC

TTTTCTGGCGACGAATTAGG

199

AG

RCS1479

3

14

GATTTCGATCCTCCTCCTCC

AATAACAATATGCGGCTTTGC

162

AAG

RCS2773

4

13

GCAGATTATGAGGAATAACATTG

AAATTATCATTTTGCAAATTTTA

182

AAT

RCS0033

5

12

TTCAATCGGGAGTGTCAGTG

CGATTGCTACAAACACAGCC

139

AC

RCS2343

6

4

GGTGCTAGCTCCAACCTCAG

CCTGCTCCGTACCATTGTTT

189

AAC

RCS1735*

7

8

GGTGGTGTTGCTGATTACGA

CCTCAGCAGAATCTTCACCC

208

AAG

RCS2667*

8

9

CCCCCAAAATACAAAACCCT

GAGAAAAGAAAGAAGTCTCTGAAGGA

220

AAG

RCS1920*

9

6

CCTTTCAGAACAGATGGCGT

TACCCTCTTGAGCACCCATT

243

AGC

RCS1928*

10

11

CGGCAGACGAAGTGACAAAT

GCCGATATTGCTAGGTTGGA

110

AC

RCS2202*

11

8

CTCGCTGAAGGAGGAAACAG

TGCAAACTCCGCTTTATGC

200

ATC

RCS1225*

12

10

AGCTCAAGCTCAACGGACAT

GGCACGAGGCACACTACTTC

107

ATC

RCS1737

13

6

CGAAGCAGGTTGGAAAACAT

GCACGAGGCACACACTACTT

188

ATC

RCS1518

14

7

TTGGCATCTCAAAGCTGAAA

GCCAAGCCCACCAATACATA

231

GGAT

RCS0843

15

15

TCTGTTTCTTGTCTCGGCCT

CATGGCTGCCTGAGGTTAAT

212

AC

RCS3666*

16

11

CACTAATTCAGACCACCAGCA

TCGGTGAGCTGTGACTAACG

217

AAC

RCS3052

17

8

AAACAAACCAAGCAGCACCT

ACGGTGGAATTATGGGATGA

244

ATC

RCS1327

18

11

TTCAACATGCAGGCTAAGAAAA

CGCAATCTTTCTTCTCATTTCA

199

AAG

RCS0793

19

8

ATGAGCACCTTCACCAATCC

CATGTCAGCATATCCATTTTCC

280

AAAG

RCS1897*

20

* Microsatellite loci that generated paraphrase products in this consider.

PCR paraphrases were carried out in a bulk of 25 μl, containing 1× buffer, 0.2 mM of each dNTP, 250 nM of each SSR primer (forward, change), 1.5 mM of MgCl2, 50-100 ng template genomic DNA and 1.2 units of Taq DNA Polymerase.

In direct to reform the PCR remainders, the apex and limitation optimal annealing skys of each span of primers to be criterioned were steadfast (See Ttalented 2.). The PCR excited form for all reputation was as follows: denaturation continuance of 4 min at 94°C, followed by twenty cycles of 1 min at 94°C, 1 min at the apex optimal sky for each primer span, and 1 min at 72°C, followed by 15 cycles of 1 min at 94°C, 1 min at the limitation optimal sky for each primer span, 1 min at 72°C, and a ultimate production for 10 min at 72°C. PCR products were disconnected on a 10% non-denaturing polyacrylamide gel using 1× TBE buffer and visualized by the silver staining course of Tixier et al. (1997), after a conjuncture the separation of using NaOH instead of NaCO3. All SSR dross for the 57 populations were scored manually.

Data separation

The remainders for the 20 loci were summarized for each reputation in a vector of 0 (no paraphrase) and 1 (fortunate paraphrase). The enumerate of whole alleles exposeed in all prospect reputation was steadfast for each SSR locus. The polymorphic advice gratified (PIC) of each SSR marker was congenial using the formula: PIC = 1 – ∑(Pi)2 (Botstein et al., 1980) where Pi is the abundance of the ith allele congenial for each SSR marker.

Results and discussion

Twenty SSR primer spans plain for T. pratense were criterioned for their force to expatiate abutting prospect other reputation of Trifolium (T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii and T. spumosum). Transferforce was fortunate for 9 (47.37%) SSRs in all reputation criterioned. From these microsatellites, all of the 9 primers were polymorphic in the target reputation.

Our remainders are in accordance after a conjuncture numerous earlier studies that possess shown interrestricted transmitforce of SSRs, for model abutting reputation of Araucariaceae (31.8 to 77.3%; Moreno et al., 2011), in the individuality Glycine (65%; Peakall, et al., 1998), from Hordeum vulgare to H. bulbosum (51.61%; Khodayari et al., 2011) and to H. chilense (26%; Castillo et al., 2008), from Arachis hypogaea to other Arachis reputation (63.1%; Gimenes et al., 2007), from Theobroma cacao to Theobroma grandiflorum (60.4%; Alves et al., 2006), and abutting reputation of the individuality Arachis (78%; Bravo et al., 2006). Usually, air-tight cognate reputation divide congruous SSR priming seats, remaindering in a excellent abundance of cantankerous-reputation paraphrase. Our findings collect distinct exemplification for the germinative transmitforce of SSRs abutting Trifolium reputation and evidence that these priming seat are located in conserved regions of the genome.

In the confer-upon consider, the enumerate of alleles exposeed at each locus ranged from 4 to 12, after a conjuncture an mediocre of 7.2 in T. tumens, 5.8 in T. resupinatum, 5.1 in T. fragiferum, 4.5 in T. tomentosum, 3.4 in T. bullatum, 3.2 in T. clusii, 2.7 in T. spumosum and 2.1 in T. physodes. A apex of 65 alleles were exposeed for T. tumens, conjuncture singly 19 alleles were exposeed for T. physodes. The enumerate of alleles exposeed by all alientalented SSR loci is listed in Ttalented 2. The enumerate of alleles for each primer steadfast in this consider is opposed from what has been reported for red clover by Sato et al. (2005), bar for the RCS1920 and RCS2667 loci (See Ttalented 1 and 2.). According to Wang et al. (2009), this may possess occurred consequently of the opposed courseologies used, namely capillary electrophoresis in the genotyping studies where these markers were originally pictorial and polyacrylamide gel electrophoresis in the confer-upon consider. Another likely sense is that these differences are the remainder of mutations in the enumerate of tandem relate polymorphisms on the criterioned loci. We as-well-mannered set-up differences in reproducibility of paraphrases, after a conjuncture varitalented remnant extents, compared after a conjuncture what has been reported for red clover by Sato et al. (2005). Bravo et al. (2006) imply that there may be considertalented mutation twain in the enumerate of repetitions as well-mannered-mannered-mannered in the levels of polymorphism between the reputation for which SSR markers were earlierly plain and the reputation that showed a cantankerous reaction.

The PIC prizes for 9 SSR primers various from 0.45 for RCS3666 to 0.65 for RCS0883 (Ttalented 2).

Ttalented 2. The remainders of cantankerous-paraphrase of red clover SSR primers abutting other Trifolium reputation.

PIC

N0. of alleles

Fragment

extent (bp)

Annealing temp.

range (°C)

SSR ID

T. spumosum

T. tomentosum

T. clusii

T. bullatum

T. resupinatum

T. tumens

T. physodes

T. fragiferum

0.65

9

9

10

9

12

10

4

11

150-230

47-55

RCS0883

0.59

1

2

2

2

3

4

1

5

190-210

48-52

RCS1225

0.64

3

7

1

4

8

10

2

11

160-310

46-52

RCS1735

0.61

1

7

5

3

9

5

1

4

220-320

46-52

RCS1920

0.51

3

4

1

4

4

5

4

4

205-250

50-58

RCS1928

0.59

1

2

2

2

4

8

1

3

190-250

48-52

RCS2667

0.45

1

1

1

1

1

4

1

2

190-235

48-52

RCS3666

0.59

4

8

6

5

5

9

4

4

75-125

48-51

RCS2202

0.51

1

1

1

1

6

10

1

2

250-320

48-52

RCS1897

0.57

2.6

4.5

3.2

3.4

5.7

7.2

2.1

5.1

   

Mean

In disposal, the cantankerous-reputation transmitforce observed in this consider evidences the profit of red clover SSRs for the separation of intra- and interrestricted genetic mutation and disconnectionary studies of other Trifolium reputation, for which no advice on genomic SSRs is advantageous. Our findings collect welcome for the body of effectual strategies for keeping of pastureland genetic media, along the lines contemplated by Barbará et al. (2007). As excellentlighted by Noor & Feder (2006), the possibility of cantankerous paraphrase of genetic markers allows relatively studies unformed air-tight cognate taxa to be carried out, as well-mannered-mannered-mannered as providing some apprehension into the genetic mechanisms of speciation and population dissipation.

 

References

Alves, R. M., Sebbenn, A. M., Artero, A. S. & Figueira, A. (2006). Microsatellite loci transmitforce from Theobroma cacao to Theobroma grandiflorum. Molecular Ecology Notes, 6, 1219-1221.

Barbará, T., Palma-Silva, C., Paggi, G. M., Bered, F., Fay, M. F. & Lexer, C. (2007). Cross-reputation transmit of nudistinct microsatellite markers: germinative and boundaryations. Molecular Ecology, 16, 3759-3767.

Botstein, D., White, R. L., Skolnick, M. & Davis, R. W. (1980). Construction of a genetic linkage map in man using limitation remnant protraction polymorphisms. The American Journal of Human Genetics, 32(3), 314–331

Bravo, J. P., Akemi, H. A., Lara, C. M., Angelici, C. D., Lopes, C. R. & Gimenes, M. A. (2006). Transferforce and use of microsatellite markers for the genetic separation of the germplasm of some Arachis individuality reputation of the individuality Arachis. Genetics and Molecular Biology, 29(3), 516-524.

Castillo, A., Budak, H., Varshney, R. K., Dorado, G., Graner, A. & Hernandez, P. (2008). Transferforce and polymorphism of barley EST-SSR markers used for phylogenetic separation in Hordeum chilense. BMC Introduce Biology, 8, 97.

Ellison, N. W., Liston, A., Steiner, J. Williams, M. & Taylor, N. (2006). Molecular phylogenesis of the Clover individuality (Trifolium – Leguminnosae). Molecular phylogenetics and disconnection, 39, 688-705.

Gillett, J. M. & Taylor, N. L. (2001). The World of Clovers. Iowa State University Press, Ames, Iowa, USA.

Gimenes, M. A., Hoshino, A. A., Barbosa, A. V. G., Palmieri, D. A. & Lopes, C. R. (2007). Characterization and transmitforce of microsatellite markers of the rationalistic peanut (Arachis hypogaea). BMC Plant. Biology, 7, 1-13.

Gutierrez, M. V., Vaz Patto, M. C., Huguet, T., Cubero, J. I., Moreno, M. T. & Torres, A. M. (2005). Cross-reputation amplification of Medicago truncatula microsatellites abutting three elder pulse crops. Theoretical and Applied Genetics, 110, 1210–1217.

Haerinasab, M. & Rahiminejad, M. R. (2012). A taxonomic cast of the individuality Trifolium L. nature. Fragifera Koch (Fabaceae) in Iran. Iranian Journal of Botany, 18 (1), 22-30.

Kalia, R. K., Rai, M. K., Kalia, S., Singh, R. & Dhawan, A. K. (2011). Microsatellites markers: an overview of the fresh advance in introduces. Euphytica, 177, 309–334.

Khodayari, H., Saeidi, H., Rahiminejad, M. R. & Komatsuda, T. (2011). Transferforce and polymorphism of barley microsatellite Markers abutting H-genome containing reputation in the individuality Hordeum (H. vulgare and H. bulbosum). Iranian Journal of Botany, 17 (2), 200-211.

Kuleung, C, Baenziger, P. S. & Dweikat, I. (2004). Transferforce of SSR markers unformed wheat, rye, and triticale. Theoretical and Applied Genetics, 108, 1147–1150.

Miranda, F. D., Gontijo, A. B. P. L., Santiliano, F. C., Favoreto, F. C. & Soares, T. C. B. (2012). Transferforce and Characterization of Microsatellite Markers in five Bromeliaceae reputation cognate to the subfamilies Pitcairnioideae and Bromelioideae. Biota Neotropica, 12(3), 319-323.

Rai, M. K., Phulwaria, M. & Shekhawat, N. S. (2013). Transferforce of uncompounded series relate (SSR) markers plain in guava (Psidium guajava L.) to impure Myrtaceae reputation. Molecular Biology Reports, 40(8), 5067-5071.

Moreno, A. C., Marchelli, P., Vendramin, G. G. & Gallo, L. A. (2011). Cantankerous transmitforce of SSRs to five reputation of Araucariaceae: a servicetalented instrument for population genetic studies in Araucaria araucana. Forest Systems, 20(2), 303-314.

Noor, M. A. F. & Feder, J. L. (2006). Speciation genetics: evolving adventes. Nature Reviews Genetics, 7, 851-861.

Peakall, R., Gilmore, S., Keys, W., Morgante, M. & Rafalski, A. (1998). Cross-reputation paraphrase of soybean (Glycine max) uncompounded series relates (SSRs) after a conjuncturein the individuality and other legume genera: implications for the transmitforce of SSRs in introduces. Molecular Biology and Evolution, 15, 1275-1287.

Sato, S., Isobe, S., Asamizu, E., Ohmido, N., Nakamura, Y., Kaneko, T., Sakurai, N., Okumura, K., Klimenko, I., Sasamoto, S., Wada, T., Watanabe, A., Kohara, M., Fujishiro, T. & Tabata, S. (2005). Comprehensive structural separation of the genome of red clover (Trifolium pratense L.). DNA Research, 12, 301-364.

Tixier, M. H., Sourdille, P., Röder, M., Leroy, P. & Bernard, M. (1997). Baffling defeat of wheat microsatellites using a non-radioactive silver-nitrate staining course. Journal of Genetics and Breeding, 51, 175-177.

Varshney, R. K., Graner, A. & Sorrells, M. E. (2005). Genic microsatellite markers in introduces: features and applications. Trends in Biotechnology, 23, 48–55.

Zhang, D. X. & Hewitt, G. M. (2003). Nudistinct DNA analyses in genetic studies of populations: experience, problems and prospects. Molecular Ecology, 12, 563-584.

Zohary, M. & Heller, D. (1984). The individuality Trifolium. The Israel Academy of Science and Humanities. Jerusalem, Israel.

Cite This Work

To export a reference to this article please select a referencing stye below:

Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.
Reference Copied to Clipboard.

Order a Unique Copy of this Paper